Disallowed spots in protein structures.

Ramachandran (ϕ, ψ) steric map was introduced in 1963 to describe available conformation space for protein structures. Subsequently, residues were observed in high-energy disallowed regions of the map. To unequivocally identify the locations of disallowed conformations of residues, we got 36 noise-free protein structures (resolution ≤1 Å, Rwork/Rfree ≤ 0.10). These stringent criteria were applied to rule out data or model errors or any crystallographic disorders. No disallowed conformation was found in the dataset. Further, we also examined disallowed conformations in a larger dataset (resolution ≤1.5 Å, devoid of any model errors, or disorders). The observed locations of disallowed residues are referred as disallowed spots. These spots include short loops of 3-5 residues, and locations where residues participate in disulfide bonding or intramolecular interactions or inter-molecular interactions with neighboring water, metals or ligands. Conformational sampling revealed that short loops in between secondary structures hardly have any opportunity to relieve from conformational strain. Residues involved in interactions, which provide energetic compensation for high-energy conformational states, were relieved from strain once the causative interaction was removed. The present study aims to identify disallowed spots in the native state of proteins, wherein residues are forced to be trapped in high-energy disallowed conformations. Moreover, it was also observed that pre-Pro, Ser, Asp, trans-Pro, Val, Asn & Gly have higher tendency to occur in disallowed conformation, which could be attributed to factors such as conformational restrictions, residue propensity of secondary structures and compensating sidechain and mainchain interactions, stabilizing turn-mimics.

Categorization of hotspots into three types - weak, moderate and strong to distinguish protein-protein versus protein-peptide interactions.

Protein-protein and protein-peptide interactions (PPI and PPepI) belong to a similar category of interactions, yet seemingly subtle differences exist among them. To characterize differences between protein-protein (PP) and protein-peptide (PPep) interactions, we have focussed on two important classes of residues-hotspot and anchor residues. Using implicit solvation-based free energy calculations, a very large-scale alanine scanning has been performed on benchmark datasets, consisting of over 5700 interface residues. The differences in the two categories are more pronounced, if the data were divided into three distinct types, namely - weak hotspots (having binding free energy loss upon Ala mutation, ΔΔG, ∼2-10 kcal/mol), moderate hotspots (ΔΔG, ∼10-20 kcal/mol) and strong hotspots (ΔΔG ≥ ∼20 kcal/mol). The analysis suggests that for PPI, weak hotspots are predominantly populated by polar and hydrophobic residues. The distribution shifts towards charged and polar residues for moderate hotspot and charged residues (principally Arg) are overwhelmingly present in the strong hotspot. On the other hand, in the PPepI dataset, the distribution shifts from predominantly hydrophobic and polar (in the weak type) to almost similar preference for polar, hydrophobic and charged residues (in moderate type) and finally the charged residue (Arg) and Trp are mostly occupied in the strong type. The preferred anchor residues in both categories are Arg, Tyr and Leu, possessing bulky side chain and which also strike a delicate balance between side chain flexibility and rigidity. The present knowledge should aid in effective design of biologics, by augmentation or disruption of PPIs with peptides or peptidomimetics.Communicated by Ramaswamy H. Sarma.

Phenylbenzopyrone of Flavonoids as a Potential Scaffold to Prevent SARSCoV-2 Replication by Inhibiting its MPRO Main Protease.

BACKGROUND: In December 2019, an outbreak of a pneumonia-like illness, Corona virus disease 2019 (COVID-19), originating from Wuhan, China, was linked to novel coronavirus, now termed SARS-CoV-2. Unfortunately, no effective drugs or vaccines have been reported yet. The main protease (MPRO) remains the most validated pharmacological target for the design and discovery of inhibitors. OBJECTIVE: The purpose of the study was to find a prospective natural scaffold as an inhibitor for MPRO main protease in SARS-CoV-2 and compare it with repurposed antiviral drugs lopinavir and nelfinavir. METHODS: Natural compound libraries were screened for potential scaffold against MPRO main protease. Molecular dynamics simulation, MM-GBSA and principal component analyses of enzyme- ligand complexes were carried out with the top-ranking hits and compared with the repurposed antiviral drugs lopinavir and nelfinavir. RESULTS: The structure-based virtual screening indicated phenylbenzopyrone of flavonoids as one of the top-ranking scaffolds that have the potential to inhibit the main protease with the Oglycosidic form, performing better than the corresponding aglyconic form. Simulation studies indicated that glycosidic form of flavonoid is a more suitable inhibitor with compounds rutin, procyanidin B6, baicalin and galloylquercetin, demonstrating high affinity and stability, and rutin, emerging as one of the best candidate compounds. Interestingly, rutin was reported to have inhibitory activity against similar protease (3Cprotease of enterovirus A71) and implicated in lung fibrosis. CONCLUSION: The present study on flavonoids, possessing a potential scaffold for inhibiting main protease activity for all betacoronavirus is an attempt to provide new and safe drug leads within a reasonably short period.

Performance Evaluation of Docking Programs- Glide, GOLD, AutoDock & SurflexDock, Using Free Energy Perturbation Reference Data: A Case Study of Fructose-1, 6-bisphosphatase-AMP Analogs.

BACKGROUND: The accurate ranking of analogs of lead molecules with respect to their estimated binding free energies to drug targets remains highly challenging in molecular docking due to small relative differences in their free energy values. METHODS: Free energy perturbation (FEP) method, which provides the most accurate relative binding free energy values were earlier used to calculate free energies of many ligands for several important drug targets including Fructose-1,6-BisphosPhatase (FBPase). The availability of abundant structural and experimental binding affinity data for FBPase inhibitors provided an ideal system to evaluate four widely used docking programs, AutoDock, Glide, GOLD and SurflexDock, distinct from earlier comparative evaluation studies. RESULTS: The analyses suggested that, considering various parameters such as docking pose, scoring and ranking accuracy, sensitivity analysis and newly introduced relative ranking score, Glide provided reasonably consistent results in all respects for the system studied in the present work. Whereas GOLD and AutoDock also demonstrated better performance, AutoDock results were found to be significantly superior in terms of scoring accuracy compared to the rest. CONCLUSION: Present analysis serves as a useful guide for researchers working in the field of lead optimization and for developers in upgradation of the docking programs.

Development of probe-based real-time loop-mediated isothermal amplification for detection of Brucella.

AIM: To develop a rapid, sensitive and specific diagnostic assay for the detection of Brucella. METHODS AND RESULTS: The probe-based RT-LAMP was carried out by using a set of four or six primers and different LAMP chemicals to compare its results with real-time PCR. Detection of gene amplification is done within 40 min and can be seen by amplification curve, turbidity and addition of DNA-binding dye at the end of the reaction results in colour difference under normal day light and in UV. The sensitivity of probe-based real-time LAMP assay was found 10-fold higher than Taqman-based qPCR. The specificity of the developed assay was validated by the absence of any cross-reaction with other pathogenic bacteria. CONCLUSION: The developed probe-based RT-LAMP assay is extremely rapid, cost effective, highly specific and sensitive, and has potential usefulness for rapid Brucella surveillance. SIGNIFICANCE AND IMPACT OF THE STUDY: The developed probe-based RT-LAMP is a powerful gene amplification technique which is a specific, fast diagnostic tool for early detection and identification of Brucella.

Predictive Models in Differentiating Vertebral Lesions Using Multiparametric MRI.

BACKGROUND AND PURPOSE: Conventional MR imaging has high sensitivity but limited specificity in differentiating various vertebral lesions. We aimed to assess the ability of multiparametric MR imaging in differentiating spinal vertebral lesions and to develop statistical models for predicting the probability of malignant vertebral lesions. MATERIALS AND METHODS: One hundred twenty-six consecutive patients underwent multiparametric MRI (conventional MR imaging, diffusion-weighted MR imaging, and in-phase/opposed-phase imaging) for vertebral lesions. Vertebral lesions were divided into 3 subgroups: infectious, noninfectious benign, and malignant. The cutoffs for apparent diffusion coefficient (expressed as 10-3 mm2/s) and signal intensity ratio values were calculated, and 3 predictive models were established for differentiating these subgroups. RESULTS: Of the lesions of the 126 patients, 62 were infectious, 22 were noninfectious benign, and 42 were malignant. The mean ADC was 1.23 ± 0.16 for infectious, 1.41 ± 0.31 for noninfectious benign, and 1.01 ± 0.22 mm2/s for malignant lesions. The mean signal intensity ratio was 0.80 ± 0.13 for infectious, 0.75 ± 0.19 for noninfectious benign, and 0.98 ± 0.11 for the malignant group. The combination of ADC and signal intensity ratio showed strong discriminatory ability to differentiate lesion type. We found an area under the curve of 0.92 for the predictive model in differentiating infectious from malignant lesions and an area under the curve of 0.91 for the predictive model in differentiating noninfectious benign from malignant lesions. On the basis of the mean ADC and signal intensity ratio, we established automated statistical models that would be helpful in differentiating vertebral lesions. CONCLUSIONS: Our study shows that multiparametric MRI differentiates various vertebral lesions, and we established prediction models for the same.

Comparative efficacy of oestrus synchronization protocols in buffalo (Bubalus bubalis).

This study was conducted to test the efficacy of gonadotropic hormone (GnRH)-based synchronization protocols (Ovsynch, Heatsynch, and Ovsynch Plus) in buffaloes under field condition. Based on anamnesis and transrectal palpation twice at 10-day interval and serum progesterone (P4) concentration, 150 anoestrous buffaloes and delayed pubertal heifers were selected to induce oestrus using GnRH-based protocols. These selected animals were randomly divided into three groups: group I: Ovsynch (n = 50), group II: Heatsynch (n = 50), and group III: Ovsynch Plus (n = 50) regimen. Before treatment initiation, blood samples were collected for P4, beta-hydroxy butyric acid (ß-OHB), and mineral estimation, in addition to the monitoring of oestrus signs. In this investigation, no significant difference (P > 0.05) in oestrus signs was deduced among three groups. Oestrus induction rate (OIR) was comparable (P > 0.05) among the groups (Ovsynch 82%, Heatsynch 86%, and Ovsynch Plus 88%). Conception rate (CR) following fixed time artificial insemination (FTAI) was slightly higher with Ovsynch Plus group (28%) as compared to Ovsynch (24%) and Heatsynch (18%) groups, though non-significant. Furthermore, serum glucose, ß-OHB, macrominerals (calcium, potassium, and magnesium), and trace minerals (copper, zinc, and iron) remained comparable (P > 0.05) among the groups. In conclusion, all the protocols (Ovsynch, Heatsynch, and Ovsynch Plus) are efficient in oestrus induction in anoestrous buffaloes under field condition with Ovsynch Plus protocol resulting in higher CR as compared to other protocols.

In silico screening for identification of novel ß-1,3-glucan synthase inhibitors using pharmacophore and 3D-QSAR methodologies.

The enzyme ß-1,3-glucan synthase, which catalyzes the synthesis of ß-1,3-glucan, an essential and unique structural component of the fungal cell wall, has been considered as a promising target for the development of less toxic anti-fungal agents. In this study, a robust pharmacophore model was developed and structure activity relationship analysis of 42 pyridazinone derivatives as ß-1,3-glucan synthase inhibitors were carried out. A five-point pharmacophore model, consisting of two aromatic rings (R) and three hydrogen bond acceptors (A) was generated. Pharmacophore based 3D-QSAR model was developed for the same reported data sets. The generated 3D-QSAR model yielded a significant correlation coefficient value (R (2) = 0.954) along with good predictive power confirmed by the high value of cross-validated correlation coefficient (Q (2) = 0.827). Further, the pharmacophore model was employed as a 3D search query to screen small molecules database retrieved from ZINC to select new scaffolds. Finally, ADME studies revealed the pharmacokinetic efficiency of these compounds.

Modeling of babesipain-1 and identification of natural and synthetic leads for bovine babesiosis drug development.

Babesiosis is a tick-borne, zoonotic disease caused by species of the intraerythrocytic protozoan Babesia. It is distributed all around the world and affects various domestic and wild animals, mainly cattle. Recently, the cysteine protease enzyme, babesipain-1 from Babesia bigemina has been identified as a potential target for designing new anti-babesiosis drugs. In the present study, a three-dimensional structural model of babesipain-1 was developed. An active site with three pockets (S1, S2, and S3), which is congruent with its homolog, falcipain-3, was also identified. Moreover, the conservation of active site residues was consistent with the cysteine protease family. In order to identify potential inhibitors, a virtual screening workflow was employed with a chemical library containing natural and synthetic compounds. Potential inhibitors interacting with all the three subsites were identified. Further, molecular dynamic simulations were carried out to assess the interactions and stability of the inhibitors. The informatics approach, and the findings presented in this study will assist researchers in further development of potential anti-babesiosis molecules.

16S rDNA analysis of archaea indicates dominance of Methanobacterium and high abundance of Methanomassiliicoccaceae in rumen of Nili-Ravi buffalo.

The molecular diversity of rumen methanogens was investigated using 16S rDNA gene library prepared from the rumen contents of Nili-Ravi buffaloes. Microbial genomic DNA was isolated from four adult male fistulated buffaloes and PCR conditions were set up using specific primers. Amplified product was cloned into a suitable vector, and the inserts of positive clones were sequenced. A total of 142 clones were examined, and the analysis revealed 46 species level (0.01 distance) operational taxonomic units (OTUs). Twenty six OTUs comprising 89 clones (63% of the total clones) were taxonomically assigned to Methanobacterium genus and the majority of them had highest percent identity with Methanobacterium flexile among cultured methanogens. Five OTUs comprising 27 clones (19% of total clones) were taxonomically assigned to Methanomicrobium genus and these clones showed highest sequence identity with Methanomicrobium mobile. Only two OTUs comprising 6 clones (4% of total clones) were assigned to Methanobrevibacter genus. A total of 17 clones belonging to 10 species level OTUs showed highest percent identity (ranging from 85 to 95%) with Methanomassilicoccus luminyensis and were taxonomically classified as Methanomassiliicocaceae. Out of the 142 rDNA clones, 112 clones, which constitute 79% of the total clones representing 42 OTUs, had less than 98.5% sequence identity with any of the cultured strains of methanogens and represent novel species of methanogens. This study has revealed the largest assortment of hydrogenotrophic methanogen phylotypes ever identified from the rumen of Nili-Ravi buffaloes. The study indicates that Methanobacterium is the most dominant methanogen in the rumen of Nili-Ravi buffalo. This is also the first report on the presence of methanogens phylogenetically close to M. luminyensis, an H2 dependent methylotrophic methanogen, in the rumen of buffaloes at such a high level of abundance.

Free energy calculations to estimate ligand-binding affinities in structure-based drug design.

Post-genomic era has led to the discovery of several new targets posing challenges for structure-based drug design efforts to identify lead compounds. Multiple computational methodologies exist to predict the high ranking hit/lead compounds. Among them, free energy methods provide the most accurate estimate of predicted binding affinity. Pathway-based Free Energy Perturbation (FEP), Thermodynamic Integration (TI) and Slow Growth (SG) as well as less rigorous end-point methods such as Linear interaction energy (LIE), Molecular Mechanics-Poisson Boltzmann./Generalized Born Surface Area (MM-PBSA/GBSA) and λ-dynamics have been applied to a variety of biologically relevant problems. The recent advances in free energy methods and their applications including the prediction of protein-ligand binding affinity for some of the important drug targets have been elaborated. Results using a recently developed Quantum Mechanics (QM)/Molecular Mechanics (MM) based Free Energy Perturbation (FEP) method, which has the potential to provide a very accurate estimation of binding affinities to date has been discussed. A case study for the optimization of inhibitors for the fructose 1,6- bisphosphatase inhibitors has been described.

Multiple infusions of CD20-targeted T cells and low-dose IL-2 after SCT for high-risk non-Hodgkin's lymphoma: a pilot study.

A pilot phase I clinical trial involving 15 infusions of anti-CD3 × anti-CD20 bispecific Ab (CD20Bi)-armed anti-CD3-activated T cells (aATC) and low-dose IL-2 was conducted in three non-Hodgkin's lymphoma (NHL) patients (two high-risk and one refractory) after autologous SCT. The feasibility of T-cell expansion, safety of aATC infusions, cytotoxic immune responses and trafficking of aATC were evaluated. Three NHL patients received 15 infusions of 5 × 10(9) aATC (three infusions/week for 3 weeks and one infusion/week for 6 weeks) between days 1 and 65 after SCT with IL-2. There were no dose-limiting toxicities. Chills, fever, hypotension and malaise were the common side effects. Engraftment was delayed in one patient with a low stem cell dose. CD20Bi aATC infusions induced specific cytotoxicity directed at lymphoma targets. Endogenous peripheral blood mononuclear cells from two patients mediated anti-lymphoma cytotoxicity above preSCT background (P<0.001). (111)In labeled aATC trafficked to the lungs at 1 h and accumulated in the liver and bone marrow after 24 h. aATC infusions given over 69 days in combination with IL-2 were safe, did not inhibit engraftment, and induced endogenous cytotoxic responses directed at lymphoma targets.

Comparative evaluation of brain neurometabolites and DTI indices following whole body and cranial irradiation: a magnetic resonance imaging and spectroscopy study.

Understanding early differential response of brain during whole body radiation or cranial radiation exposure is of significant importance for better injury management during accidental or intentional exposure to ionizing radiation. We investigated the early microstructural and metabolic profiles using in vivo diffusion tensor imaging (DTI) and proton magnetic resonance spectroscopy ((1)H MRS) following whole body and cranial radiation exposure of 8 Gy in mice using a 7.0 T animal MRI system and compared profiles with sham controls at days 1, 3, 5 and 10 post irradiation. A significant decrease in fractional anisotropy (FA) values was found in hippocampus, thalamic and hypothalamic regions (p < 0.05) in both whole body and cranial irradiated groups compared with controls, suggesting radiation induced reactive astrogliosis or neuroinflammatory response. In animals exposed to whole body radiation, FA was significantly decreased in some additional brain regions such as sensory motor cortex and corpus callosum in comparison with cranial irradiation groups and controls. Changes in FA were observed till day 10 post irradiation in both the groups. However, MRS study from hippocampus revealed changes only in the whole body radiation dose group. Significant reduction in the ratios of the metabolites myoinositol (mI, p = 0.02) and taurine (tau, p = 0.03) to total creatine were observed, and these metabolic alterations persisted till day 10 post irradiation. To the best of our knowledge this study has for the first time documented a comparative account of microstructural and metabolic aspects of whole body and cranial radiation induced early brain injury using in vivo MRI. Overall our findings suggest differential response at microstructure and metabolite levels following cranial or whole body radiation exposure.

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes.

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method.

Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes.

T1-weighted dynamic contrast-enhanced MR evaluation of different stages of neurocysticercosis and its relationship with serum MMP-9 expression.

BACKGROUND AND PURPOSE: Epileptogenesis in NCC is associated with perilesional inflammation and disruption in BBB. We quantified BBB in different stages of NCC by using DCE-MR imaging to look for the differences in perfusion indices and to correlate these indices with serum MMP-9 expression. MATERIALS AND METHODS: DCE-MR imaging along with conventional MR imaging was performed in 57 single cysticercous brain lesions to quantify the kep, K(trans), and ve around the lesions, which were in different stages of evolution. There were 6 lesions in the vesicular stage and 17 lesions each in the colloidal, granular-nodular, and calcified stages. Serum MMP-9 was quantified from all patients, whereas perfusion indices were quantified from all stages except for the vesicular stage. RESULTS: We observed significant differences among the 3 stages of NCC in serum MMP-9 expression as well as DCE-derived kep values. In addition, kep showed a strongly significant positive correlation with MMP-9 expression when modeled with the individual stage of the disease as well as with all stages when pooled together. Other DCE-derived hemodynamic and pharmacokinetic parameters showed inconsistent differences with each stage of the disease. The correlation of DCE-derived parameters with serum MMP-9 expression and edema volume also showed inconsistency with the stage of the disease. CONCLUSIONS: We conclude that kep correlates best with serum MMP-9 expression among the pharmacokinetic indices and most closely represents the degree of BBB breakdown, which is highest in the colloidal stage and lowest in the calcified stage. kep may be used as a noninvasive image biomarker of BBB breakdown in different stages of NCC.

HIV-1 associated Topoisomerase IIß kinase: a potential pharmacological target for viral replication.

Viruses have been found to exhibit protein kinase activity associated with their purified viral particles. HIV-1 virus particles possess a novel 72 kD protein, Topoisomerase II beta kinase (Topo IIßKHIV) activity. The enzyme, isolated and purified from PEGprecipitated HIV-1 particles, is insensitive against a diverse set of known kinase inhibitors. The pyridine derivatives were found to be active against both Topo IIßKHIV activity and HIV-1 replication. For both kinase antagonism and anti-HIV-1 activity the Comparative Molecular Field Analysis (CoMFA) models were proposed. The CoMFA model was also evaluated independently with a set of test molecules for their anti-viral activity. The kinase inhibition and anti-viral activities for these inhibitors, tested in an in vitro kinase agree with the CoMFA model (cross-validated r2 (q2) value of 0.642 with six principal components), lower acceptable results are obtained with anti- HIV-1 activity (cross-validated r2 (q2) value of 0.358 with four principal components) and also correlate with relative solvation free energy calculations. The predictive power of the models was evaluated with 2 test molecules each and tends to lie within 1 log unit. An in cell validation of the model with a representative inhibitor, 2-methoxypyridine shows its ability to inhibit Topo IIß phosphorylation during acute HIV-1 infection. Close correlation of molecular fields of inhibitory domains of kinase and HIV-1 inhibitors suggests specificity of action of pyridine derivatives in affecting HIV-1 replication through inhibition of Kinase activity. These investigations suggest that Topo IIßKHIV is a potential target for an effective control of HIV-1 replication that would help in developing new anti-retroviral molecules.

Advances in binding free energies calculations: QM/MM-based free energy perturbation method for drug design.

Multiple approaches have been devised and evaluated to computationally estimate binding free energies. Results using a recently developed Quantum Mechanics (QM)/Molecular Mechanics (MM) based Free Energy Perturbation (FEP) method suggest that this method has the potential to provide the most accurate estimation of binding affinities to date. The method treats ligands/inhibitors using QM while using MM for the rest of the system. The method has been applied and validated for a structurally diverse set of fructose 1,6- bisphosphatase (FBPase) inhibitors suggesting that the approach has the potential to be used as an integral part of drug discovery for both lead identification lead optimization, where there is a structure available. In addition, this QM/MM-based FEP method was shown to accurately replicate the anomalous hydration behavior exhibited by simple amines and amides suggesting that the method may also prove useful in predicting physical properties of molecules. While the method is about 5-fold more computationally demanding than conventional FEP, it has the potential to be less demanding on the end user since it avoids development of MM force field parameters for novel ligands and thereby eliminates this time-consuming step that often contributes significantly to the inaccuracy of binding affinity predictions using conventional FEP methods. The QM/MM-based FEP method has been extensively tested with respect to important considerations such as the length of the simulation required to obtain satisfactory convergence in the calculated relative solvation and binding free energies for both small and large structural changes between ligands. Future automation of the method and parallelization of the code is expected to enhance the speed and increase its use for drug design and lead optimization.